Choosing the Exon 50 Skipping Oligomer That Could Be Made Nine Sequences, One That Dissolves

This application claims short synthetic strands of nucleic acid analogue designed to make cells skip exon 50 of the human dystrophin gene, a strategy aimed at some forms of Duchenne muscular dystrophy. Claim 1 lists nine specific target sequences. The worked examples show why one of them, a 23-base sequence, is the one that could actually be manufactured and attached to a cell-penetrating peptide. Sarepta Therapeutics, Inc. filed it as a divisional of Australian application 2019397461 and names Frederick Joseph Schnell, Baozhong Cai, Ankur Desai and Richard K. Bestwick as inventors.

The Problem

Duchenne muscular dystrophy is caused by a defect in the production of the protein dystrophin. The specification notes that the gene has 79 exons spread over more than 2 million nucleotides of DNA, and that any change that shifts the reading frame, introduces a stop codon, or removes or duplicates exons in an out-of-frame way can stop functional dystrophin being made. A milder disease, Becker muscular dystrophy, arises when a deletion leaves the reading frame intact and a shortened but partly working protein is produced.

Exon skipping tries to turn the first condition into the second. An antisense strand binds the pre-messenger RNA and hides an exon from the splicing machinery, so the cell reads a shorter, in-frame message. The specification states the gap plainly: there is a need for antisense oligomers suited to exon 50 skipping, and for pharmaceutical compositions that can produce dystrophin and treat the disease.

The examples add a practical problem that sequence alone does not solve. A drug has to be made at scale, dissolve in water and be purified. Two of the obvious exon 50 sequences failed on exactly those tests.

What This Invention Does

Claim 1 covers an antisense oligomer, or a pharmaceutically acceptable salt of one, that binds a target region in exon 50 of the dystrophin pre-mRNA, where the base sequence and annealing site are one of nine listed. They are named by position, for example H50D(+07-16), H50A(-19+07) and H50D(+07-20), and correspond to SEQ ID NOS 1 and 3 to 9. SEQ ID NO 2 appears in the description but is not in the list in claim 1.

The remaining claims describe what the oligomer is built from. Claim 2 allows a tail moiety at the 5′ end and an optional link to a cell-penetrating peptide. Claims 3 to 5 attach an arginine-rich cell-penetrating peptide at the 3′ end, from a list that includes the six-arginine peptide with and without a glycine spacer. Claim 6 puts the bases on morpholino ring structures. Claims 7, 17 and 22 give three structural formulae, claim 23 selects SEQ ID NO 3 in the third, and claims 26 to 29 cover treating Duchenne muscular dystrophy and restoring the reading frame in patients whose mutation is amenable to exon 50 skipping.

The data that explain the shortlist are in Example 1. The sequence called PMO#1 (SEQ ID NO 1, 22 bases) could not be formulated because of limited solubility: the crude material precipitated out after storage. PMO#2 (25 bases) could not be made with enough yield and purity to carry forward. PMO#3, SEQ ID NO 3 and 23 bases, differs from PMO#2 only by two bases at the 5′ end, and had no solubility or purification trouble. It came out at 91 per cent purity and dissolves in water, which allowed the peptide-conjugated version, PPMO#3, to be made.

Example 3 then tests PMO#3 and PPMO#3 in healthy human myotubes at doses from 1.25 to 40 micromolar, measuring skipped and unskipped product by RT-PCR across exons 49 to 52. Relative to the bare PMO set at 1, the conjugate gave 2.6, 3.2, 3.0, 2.4, 2.1 and 1.9 times as much skipping at 1.25, 2.5, 5, 10, 20 and 40 micromolar respectively. Example 4, in cynomolgus monkeys, is written as a protocol and gives no results.

Key Features

• Nine named annealing sites. Claim 1 lists nine sequences in exon 50 and the surrounding intron boundaries, including both donor-side (H50D) and acceptor-side (H50A) sites.
• Thymine or uracil. Each T in the listed sequences may be thymine or uracil, and the description says in one aspect each T is thymine.
• Morpholino backbone. The bases sit on morpholino rings, a chemistry the specification describes as resistant to nucleases and proteases.
• Arginine-rich peptide attachment. The oligomer can carry a cell-penetrating peptide such as a six-arginine chain with a glycine linker, written -GLY-R6-Ra, which is the conjugate used for PPMO#3.
• A selected winner. SEQ ID NO 3 (GATCCAGTATACTTACAGGCTCC) is picked out in claim 23 as the sequence for the Formula IV oligomer.
• Treatment claims. Claims 26 to 29 cover administering a therapeutically effective amount to treat Duchenne muscular dystrophy or to restore the mRNA reading frame, in patients with a mutation amenable to exon 50 skipping.

Who Is Behind It

The applicant is Sarepta Therapeutics, Inc., a United States company that describes itself on sarepta.com as focused on precision genetic medicines for rare neuromuscular and central nervous system diseases, with Duchenne muscular dystrophy listed first. Its history is set out in the Wikipedia entry for Sarepta Therapeutics, which records its roots as AntiVirals in 1980 and its present headquarters in Cambridge, Massachusetts. The company commercialises morpholino exon-skipping drugs against other exons, among them eteplirsen, which skips exon 51 and received accelerated FDA approval in 2016.

On the family position, the body of the specification says only that this is a divisional of Australian application 2019397461 and that the sequence listing was prepared for that application. It states no priority claim in the text. The sequence listing sheet attached to the document does record an earliest priority application at the US Patent Office, number 62/779,028, dated 13 December 2018, so the United States is shown as the priority country on that evidence alone.

Why It Matters

Exon skipping is exon specific. A drug that skips exon 51 helps only patients whose mutation can be corrected that way, so each additional exon needs its own oligomer, and each one has to survive chemistry and manufacturing before it can be tested in patients. This application is a record of that filtering at the earliest stage: nine candidate sequences claimed, and a worked comparison showing which ones fail on solubility and purification.

The comparison with peptide conjugation is the other point. The data show that adding the arginine-rich peptide raised skipping in cultured human muscle cells by roughly two to three times at every dose tested, though the effect was smaller at the highest doses. The specification is silent on results in animals, and the monkey study is described only as a planned method.

Related Concepts

• Exon skipping – the splicing strategy that turns an out-of-frame dystrophin message into an in-frame one.
• Morpholino – the nuclease-resistant backbone chemistry the claimed oligomers are built on.
• Cell-penetrating peptide – the arginine-rich peptide class attached to improve uptake into muscle cells.
• Dystrophin – the protein whose production the treatment aims to restore.
• Eteplirsen – the approved exon 51 morpholino drug from the same company, for comparison.

---

AU 2026202254 was published in the Australian Official Journal of Patents on 16 April 2026 and is open for public inspection. Patent applications represent inventions that are sought to be protected and do not necessarily reflect commercially available products.